View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11117_high_16 (Length: 459)
Name: NF11117_high_16
Description: NF11117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11117_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 118 - 448
Target Start/End: Original strand, 43003211 - 43003542
Alignment:
| Q |
118 |
tgaaatttcttgtaccataacgaagaatattttcctcctattagatattaatcatataacgtgc-tgatatctttatttgaattgaagttgaagcttaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43003211 |
tgaaatttcttgtaccataacgaagaatattttcctcctattagatattaatcatataacgtgcgtgatatctttatttggattgaagttgaagcttaga |
43003310 |
T |
|
| Q |
217 |
gatccaatgaatttaagccagtcatagggtcaacctagttatccnnnnnnnttatcttatggtcaaaccaatattgcacaatgtggcatgttcttagaat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003311 |
gatccaatgaatttaagccagtcatagggtcaacctagttatccaaaaaaattatcttatggtcaaaccaatattgcacaatgtggcatgttcttagaat |
43003410 |
T |
|
| Q |
317 |
agccaacatcccatttgctaaaccctaggggcctgcatgcctagaattacgggtttatgtactcatctcttacttcgttgtctgttttcaatcgaaacaa |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43003411 |
agccaacatcccatttgctaaaccctaggggcctgcatgcctagaattacgggtttatgtactcatctcttacttccttgtctgttttcaatcgaaacaa |
43003510 |
T |
|
| Q |
417 |
acattatgtttactatgcttagcccatttcat |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43003511 |
acattatgtttactatgcttagcccatttcat |
43003542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 51 - 99
Target Start/End: Complemental strand, 14461055 - 14461007
Alignment:
| Q |
51 |
ttggagctgagcctgggctgcccaagctcgctggagttggctccgcccc |
99 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| | ||||||||||| |
|
|
| T |
14461055 |
ttggagctgagcctgggcagcccaggctcgctgggggaggctccgcccc |
14461007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University