View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11117_high_24 (Length: 376)
Name: NF11117_high_24
Description: NF11117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11117_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 11 - 358
Target Start/End: Original strand, 24212271 - 24212618
Alignment:
| Q |
11 |
cacagagaacggtccagcaactgaggtatccacgtcagatgccttgcaagtaattcaggctgctcagctggcaggagtaggccacgttgcagtcatctac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24212271 |
cacagagaacggtccagcaactgaggtatccacgtcagacgccttgcaagtaattcaggctgctcagctggcaggcgtaggccacgttgcagtcatctac |
24212370 |
T |
|
| Q |
111 |
gatgaaaacaacggtgtcagcacctcaacctacaatgtacttgatggcatctcctctttcttcaacaatatcttctccaagtctcaacctttgtctattc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24212371 |
gatgaaaacaacggtgtcagcacctcaacctacaatgtacttgatggcatctcctctttcttcaacaatatcttctccaagtctcaacctttgtctattc |
24212470 |
T |
|
| Q |
211 |
aagagttcttgcagaaagtggttgaaacagatgtcaaatataccttaatcaaaacatgtttgaccgatgattttgcaccggagagttcttataatgtggt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24212471 |
aagagttcttgcagaaagtggttgaaacagatgtcaaatataccttaatcaaaacatgtttgaccgatgattttgcaccggagagttcttataatgtggt |
24212570 |
T |
|
| Q |
311 |
tgtcttaggcgaagaaaacaccggttcgaacgactataaagtaatgta |
358 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24212571 |
tgtcttaggtgaagaaaacaccggttcgaacgactataaagtaatgta |
24212618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University