View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11117_high_32 (Length: 329)
Name: NF11117_high_32
Description: NF11117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11117_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 260
Target Start/End: Original strand, 45362532 - 45362777
Alignment:
| Q |
15 |
gaggacttgtaattatgataattcagtgtctacgacaaaggggaattaccctgcgccaaaccccgaaatgttctctccaaaaaacgttgctgctgctaag |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45362532 |
gaggacttgtaattatgataattcaatgtctacgacaaaggggaattaccctgcgccaaaccccgaaatgttctctccaaaaaacgttgttgctgctaag |
45362631 |
T |
 |
| Q |
115 |
aaaacgaaggatcttgatatgnnnnnnnggagttcaagtgattcccttgtttctgatgttaaattgaatgtctctccagaaaaaggtttcttttaattat |
214 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362632 |
aaaacggaggatcttcatatgtttttttggagttcaagtgattcccttgtttctgatgttaaattgaatgtctctccagaaaaaggtttcttttaattat |
45362731 |
T |
 |
| Q |
215 |
tttttactaatagttgtttgcttatattgattgattggttgacatg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362732 |
tttttactaatagttgtttgcttatattgattgattggttgacatg |
45362777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 311
Target Start/End: Original strand, 45362797 - 45362825
Alignment:
| Q |
283 |
gtcagtggagggtgaggatgagcacaaga |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45362797 |
gtcagtggagggtgaggatgagcacaaga |
45362825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University