View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11117_high_46 (Length: 248)
Name: NF11117_high_46
Description: NF11117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11117_high_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 32798589 - 32798817
Alignment:
| Q |
1 |
ttggaagattaatggatactcgtgacactttatcttgagaaaagtgtgctttctaagcttccatagccatgtgtaaggtcaaagacatgaattgaaaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32798589 |
ttggaagattaatggatactcgtgacactttatcttgagaaaagtgtgctttctaagcttccatagccatgtgtaaggtcaaagacatgaattgaaaagt |
32798688 |
T |
|
| Q |
101 |
taaattagggcatcacatgtggatgaggttgttgtctcagtctaagcttttacccacgttgtatccacattttacttttcatcttcaaaaatatagcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32798689 |
taaattagggcatcacatgtggatgaggttgttgtctcagtctaagcttttacccacgttgtatccacattttacttttcatcttcaaaaatatagcttt |
32798788 |
T |
|
| Q |
201 |
agctacaaaaccaaggacgatatggtagg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32798789 |
agctacaaaaccaaggacgatatggtagg |
32798817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University