View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11117_low_23 (Length: 376)
Name: NF11117_low_23
Description: NF11117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11117_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 3e-98; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 112 - 360
Target Start/End: Complemental strand, 1741689 - 1741440
Alignment:
| Q |
112 |
gacaccaatgagaatttgaaaaaacggaattattgaattcaaacacatgtgtcagtatcgtgttgatgtcagacaccggacacaccttcaacctgaggtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
1741689 |
gacaccaatgagaatttgaaaaaacggaattattgaattcaaacacatgtgtcagtattgtgttgatgtcagacatcggacacaacgtcaacctgaggtt |
1741590 |
T |
 |
| Q |
212 |
tcaatgctacaaagcaactattaagcttgactct-aaagtactccatcgaacaacattacttgcaatttttccttcgttgttctcttgactcaacgattt |
310 |
Q |
| |
|
| | ||||||||||||||||||| |||||| || ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1741589 |
ttgaagctacaaagcaactattaaacttgacactgaaagtactccatcgagcaacattacttgcaatttttccttcgtttttctcttgactcaacgattt |
1741490 |
T |
 |
| Q |
311 |
ctctgatacaactattgatatctcacaagaatttccttaacagatgatct |
360 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
1741489 |
ctctgatacaattattgttatctcacaagaacttccttaaaagatgatct |
1741440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 21 - 103
Target Start/End: Complemental strand, 1742460 - 1742378
Alignment:
| Q |
21 |
tcaaaattgttggtatgttacagctaagggagtaagggaagtaatagaaaattgcatagcattgaaagagttaaatttgagga |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1742460 |
tcaaaattgttggtatgttacagctaagggagtaagggaagtaatagaaaattgcatagcattgaaagagttaaatttgagga |
1742378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 25 - 97
Target Start/End: Original strand, 2007879 - 2007951
Alignment:
| Q |
25 |
aattgttggtatgttacagctaagggagtaagggaagtaatagaaaattgcatagcattgaaagagttaaatt |
97 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| ||||||| || | |||||| ||||||||||||| |
|
|
| T |
2007879 |
aattgttggcatgttacaactaagggagtaagggaagtattagaaaagtgtacagcattaaaagagttaaatt |
2007951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 218
Target Start/End: Complemental strand, 30711709 - 30711667
Alignment:
| Q |
177 |
atgtcagacac-cggacacaccttcaacctgaggtttcaatgc |
218 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
30711709 |
atgtcagacactcggacacgccttcaacctgaggtttcaatgc |
30711667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 155 - 199
Target Start/End: Original strand, 16567338 - 16567382
Alignment:
| Q |
155 |
cacatgtgtcagtatcgtgttgatgtcagacaccggacacacctt |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
16567338 |
cacatgtgtcagtatcgtgttggtgtcaaacaccggacacacctt |
16567382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 188
Target Start/End: Complemental strand, 9381378 - 9381345
Alignment:
| Q |
155 |
cacatgtgtcagtatcgtgttgatgtcagacacc |
188 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
9381378 |
cacatgtgtcagtatcgtgttgatatcagacacc |
9381345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University