View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11117_low_36 (Length: 312)
Name: NF11117_low_36
Description: NF11117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11117_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 304
Target Start/End: Complemental strand, 30407233 - 30406930
Alignment:
| Q |
1 |
taaaaattactacttttggatactttaaacaatgcctagaggacacttgtttgtattttctctaaaataattccaacattaagttgaaggaggttgttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30407233 |
taaaaattactacttttggatactttaaacaatgcctagaggacacttgtttgtattttctttaaaataattccaacattaagttgaaggaggttgttta |
30407134 |
T |
|
| Q |
101 |
tgtgatgtagttaaagtcatatctgtttggacaaggagattgacggtttaggggcaaggagaatgagggagtttaatatggttggataaatggtattgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30407133 |
tgtgatgtagttaaagtcatatctgtttggataaggagattggcggtttaggggcaaggagaatgagggagtttaatatggttggataaatggtattgga |
30407034 |
T |
|
| Q |
201 |
ggtaggtggcagacaaagggtctttggtttagactcttggctgctagatatggcctagcggggggtcgagtacctttattttggtaggtgggttgatgat |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30407033 |
ggtaggtggcagacgaagggtctttggtttagactcttggctgctagatatggcctagtgggggatcgagtacctttattttggtaggtgggttgatgat |
30406934 |
T |
|
| Q |
301 |
gtcc |
304 |
Q |
| |
|
|||| |
|
|
| T |
30406933 |
gtcc |
30406930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 30403254 - 30403149
Alignment:
| Q |
1 |
taaaaattactacttttggatactttaaacaatgcctagaggacacttgtttgtattttctctaaaataattccaacattaagttgaaggaggttgttta |
100 |
Q |
| |
|
||||| ||| ||||||||||| ||| |||||| ||||| || ||||||| |||||| |||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
30403254 |
taaaagttattacttttggatgcttcaaacaacgcctaaag-acacttgc----attttccttaaaataattccaatattaagttggaggaggttgttta |
30403160 |
T |
|
| Q |
101 |
tgtgatgtagt |
111 |
Q |
| |
|
| | ||||||| |
|
|
| T |
30403159 |
tattatgtagt |
30403149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 121 - 181
Target Start/End: Complemental strand, 25132828 - 25132768
Alignment:
| Q |
121 |
atctgtttggacaaggagattgacggtttaggggcaaggagaatgagggagtttaatatgg |
181 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||| ||||||||| || ||||||||||||| |
|
|
| T |
25132828 |
atctgtttggacaaggaggttggtggtttggggctaaggagaattagagagtttaatatgg |
25132768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University