View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11117_low_43 (Length: 253)
Name: NF11117_low_43
Description: NF11117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11117_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 248
Target Start/End: Original strand, 2889758 - 2889992
Alignment:
| Q |
16 |
gagacacttgtgtatccgatgaaccttcgccggtaacctcgccggtttcttggactcattgtcgggagttttgaaacccaatcttgccttcactttannn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2889758 |
gagacacttgtgtatccgatgaaccttcgccggtaaccttgccggtttcttggactcattgtcgggagttttgaaacccaatcttgccttcactttattt |
2889857 |
T |
 |
| Q |
116 |
nnnn--attctttttccacatctattttgcgttatgatttctacatgaagaaaggccagttaaaatattatgaaaactttgaaaatatggttgaaaaaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2889858 |
ttttttattctttttccacatctattttgcgttatgatttctacatgaagaaaggccagttaaaatattatgaaaactttgaaaatatggttgaaaaaga |
2889957 |
T |
 |
| Q |
214 |
aagaaatgctaattatagtcatgtttcttcttctt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2889958 |
aagaaatgctaattatagtcatgtttcttcttctt |
2889992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University