View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11117_low_51 (Length: 241)
Name: NF11117_low_51
Description: NF11117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11117_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 30621233 - 30621380
Alignment:
| Q |
1 |
aacaagttcatagaggccatatgatttttgtgaaagnnnnnnn--gacaaagagagatcggtgagaaagaaaactaaagtgtagactagaggttaaaata |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30621233 |
aacaagttcatagaggccatatgatttttgtgaaagaaaaaaaaagacaaagagagatcggtgagaaagaaaactaaagtgtagactagaggttaaaata |
30621332 |
T |
|
| Q |
99 |
gaagtggtttgtgatatgcatgaagtggaggaggtagcacaagttatg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30621333 |
gaagtggtttgtgatatgcatgaagtggaggaggtagcacaagttatg |
30621380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University