View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11117_low_55 (Length: 222)
Name: NF11117_low_55
Description: NF11117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11117_low_55 |
 |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 77 - 149
Target Start/End: Original strand, 101175 - 101248
Alignment:
| Q |
77 |
tttacttttggcttactgtatttctattatatt-tttaaagtttgatatgctatgcagtactaatgttttcttc |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
101175 |
tttacttttggcttactgtatttctattatattctttaaagtttgatatgctatgcagtactaatgttttcttc |
101248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 184
Target Start/End: Original strand, 101270 - 101300
Alignment:
| Q |
154 |
ggatttgatccttctgatattggaccacaga |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
101270 |
ggatttgatccttctgatattggaccacaga |
101300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University