View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11119_high_19 (Length: 243)
Name: NF11119_high_19
Description: NF11119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11119_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 103 - 231
Target Start/End: Complemental strand, 1415614 - 1415486
Alignment:
| Q |
103 |
gggtgttgttttcctattgttgtggactaatgtagatcaagtggattaatagtagttgcaaacgaacaaagttgtgttgaaaccaagggacaaaaagata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1415614 |
gggtgttgttttcctattgttgtggactaatgtagatcaagtggattaatagtagttgcaaacgaacaaagttgtgttgaaaccaagggacaaaaagata |
1415515 |
T |
 |
| Q |
203 |
aattaacatgactgtcaggtcactccctt |
231 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
1415514 |
aattagcatgactgtcaggtcactccctt |
1415486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 1415670 - 1415599
Alignment:
| Q |
17 |
agttgcttatttatgaaattggttcttgtggagattcaatataatttgtctctcatgggtgttgttttccta |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1415670 |
agttgcttatttatgaaattggttcttgtggagattcaatagaatttgtctctcatgggtgttgttttccta |
1415599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 103 - 170
Target Start/End: Complemental strand, 1422007 - 1421940
Alignment:
| Q |
103 |
gggtgttgttttcctattgttgtggactaatgtagatcaagtggattaatagtagttgcaaacgaaca |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
1422007 |
gggtgttgttttcctattgttttggactaatgtagatcaggtggattaatagtagttgcaaaccaaca |
1421940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 1422063 - 1421992
Alignment:
| Q |
17 |
agttgcttatttatgaaattggttcttgtggagattcaatataatttgtctctcatgggtgttgttttccta |
88 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||| |||||| |||| | |||||||||||||||| |
|
|
| T |
1422063 |
agttgtttatttatgaaattggtttttgtggagattcaatagaatttgcctcttaggggtgttgttttccta |
1421992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University