View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11119_high_9 (Length: 370)
Name: NF11119_high_9
Description: NF11119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11119_high_9 |
 |  |
|
| [»] scaffold0006 (4 HSPs) |
 |  |  |
|
| [»] scaffold0069 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 6e-56; HSPs: 11)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 109 - 219
Target Start/End: Complemental strand, 13417290 - 13417180
Alignment:
| Q |
109 |
tatatgagataactttccatcactatttctgagtacctctaaccaatctcttcatagtgtggtacaaattaaagatgcagaaaatatgagataactttcc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13417290 |
tatatgagataactttccatcactatttctgagtacctctaaccaatctcttcatagtgtggtacaaattaaagatgcagaaaatatgagataactttcc |
13417191 |
T |
 |
| Q |
209 |
atcacttccaa |
219 |
Q |
| |
|
||||||||||| |
|
|
| T |
13417190 |
atcacttccaa |
13417180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 156 - 219
Target Start/End: Complemental strand, 13680058 - 13679995
Alignment:
| Q |
156 |
ctcttcatagtgtggtacaaattaaagatgcagaaaatatgagataactttccatcacttccaa |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13680058 |
ctcttaatagtgtggtacaaattaaagatgcagaaaatatgagataactttccatcacttccaa |
13679995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 297 - 354
Target Start/End: Complemental strand, 13679916 - 13679859
Alignment:
| Q |
297 |
cgtcagatctcttagtataattaaagagacaaattaatagtggagcaaagtcactttt |
354 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
13679916 |
cgtcaaatctcttagtataattaaagagacaaattaatagtggggcagagtcactttt |
13679859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 297 - 354
Target Start/End: Complemental strand, 13417101 - 13417044
Alignment:
| Q |
297 |
cgtcagatctcttagtataattaaagagacaaattaatagtggagcaaagtcactttt |
354 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
13417101 |
cgtcaaatctcttagtataattaaagaggcaaattaatagtggggcagagtcactttt |
13417044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 13417385 - 13417345
Alignment:
| Q |
14 |
gaacagaatatatgagataacctttgaaactgaatgatctg |
54 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13417385 |
gaacagaatataggagataacctttgaaactgaatgatctg |
13417345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 12 - 51
Target Start/End: Original strand, 15904181 - 15904220
Alignment:
| Q |
12 |
atgaacagaatatatgagataacctttgaaactgaatgat |
51 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15904181 |
atgaacagaatatatgagataacctttaaaactgaatgat |
15904220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 170 - 214
Target Start/End: Complemental strand, 13535068 - 13535022
Alignment:
| Q |
170 |
gtacaaattaaagatgcagaaaatat--gagataactttccatcact |
214 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
13535068 |
gtacaaattaaaaatgcagaaaatatatgagataactttccatcact |
13535022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 142
Target Start/End: Complemental strand, 13538159 - 13538126
Alignment:
| Q |
109 |
tatatgagataactttccatcactatttctgagt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
13538159 |
tatatgagataactttccatcactatttttgagt |
13538126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 142
Target Start/End: Original strand, 19066161 - 19066194
Alignment:
| Q |
109 |
tatatgagataactttccatcactatttctgagt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
19066161 |
tatatgagataactttccatcactatttttgagt |
19066194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 142
Target Start/End: Original strand, 19114051 - 19114084
Alignment:
| Q |
109 |
tatatgagataactttccatcactatttctgagt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
19114051 |
tatatgagataactttccatcactatttttgagt |
19114084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 170 - 215
Target Start/End: Complemental strand, 20472186 - 20472139
Alignment:
| Q |
170 |
gtacaaattaaagatgcagaaa--atatgagataactttccatcactt |
215 |
Q |
| |
|
|||||||||||| ||||||||| |||||| ||||||||||||||||| |
|
|
| T |
20472186 |
gtacaaattaaaaatgcagaaaatatatgatataactttccatcactt |
20472139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 54; Significance: 6e-22; HSPs: 4)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 151 - 216
Target Start/End: Complemental strand, 47506 - 47441
Alignment:
| Q |
151 |
ccaatctcttcatagtgtggtacaaattaaagatgcagaaaatatgagataactttccatcacttc |
216 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47506 |
ccaatcacttcatagtgcggtacaaattaaagatgcagaaaataagagataactttccatcacttc |
47441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 109 - 153
Target Start/End: Complemental strand, 47585 - 47541
Alignment:
| Q |
109 |
tatatgagataactttccatcactatttctgagtacctctaacca |
153 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47585 |
tatatgagataactttccatcactatttttgagtacctctaacca |
47541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 47732 - 47692
Alignment:
| Q |
14 |
gaacagaatatatgagataacctttgaaactgaatgatctg |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47732 |
gaacagaatatatgagataacctttgaaactgaatgatctg |
47692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 142
Target Start/End: Complemental strand, 94885 - 94852
Alignment:
| Q |
109 |
tatatgagataactttccatcactatttctgagt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
94885 |
tatatgagataactttccatcactatttttgagt |
94852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0069 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0069
Description:
Target: scaffold0069; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 142
Target Start/End: Complemental strand, 20634 - 20601
Alignment:
| Q |
109 |
tatatgagataactttccatcactatttctgagt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
20634 |
tatatgagataactttccatcactatttttgagt |
20601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University