View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11119_low_10 (Length: 422)
Name: NF11119_low_10
Description: NF11119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11119_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 12 - 308
Target Start/End: Complemental strand, 26000635 - 26000337
Alignment:
| Q |
12 |
ggatggttcgtgattttagggaggttcacactaatgttccgattcgattgcgtctattctataatagaaattaccaccctcggacttataatgtcctcga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||| ||| ||| ||||||||||||||||| |
|
|
| T |
26000635 |
ggatggttcgtgattttagggaggttcacactaatgttccggttcgattgcgtttattctgtaatagaaattacgaccttcgaacttataatgtcctcga |
26000536 |
T |
|
| Q |
112 |
agttggttaggttgcgactttgatcattagagattttgatagttc--aagatggacgagatattgttgttcgagaaaatgatggtaatatgcagcagata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26000535 |
agttggttaggttgcgactttgatcattggagaatttgatagttctgaagatggacgggatattgttgttcgagaaaatgatggtaatttgcagcagata |
26000436 |
T |
|
| Q |
210 |
catgaaagccatgccaaataacttcctttacaacattgctatttccttttggtgaacatcattatcaagaacacattgaacttaatgaattgacagtgt |
308 |
Q |
| |
|
|||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26000435 |
catgaaagtcatgtcaaataccttcctttacaacattgctatttccttttggtgaacatcattatcaagaacacattgaacttaatgaattgacagtgt |
26000337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 333 - 405
Target Start/End: Complemental strand, 26000340 - 26000268
Alignment:
| Q |
333 |
gtgtttctacgagggagtttattgctttaagattgcaagagagggatcttgaagattcgggggagacgtttat |
405 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26000340 |
gtgtttctattagggagtttgttgctttaagattgcaagagagagatcttgaagattcgggggagacgtttat |
26000268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 143 - 229
Target Start/End: Original strand, 25917519 - 25917607
Alignment:
| Q |
143 |
gattttgatagttc--aagatggacgagatattgttgttcgagaaaatgatggtaatatgcagcagatacatgaaagccatgccaaata |
229 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||| ||||| ||| | ||| ||||||||||| ||||||||||| |
|
|
| T |
25917519 |
gattttgatagttcggaagatggcagagatattgttgttcgagaaagagatggaaatcttcagaggatacatgaaacacatgccaaata |
25917607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University