View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_high_101 (Length: 324)
Name: NF1111_high_101
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_high_101 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 16910669 - 16910894
Alignment:
| Q |
1 |
tggggtgtccgttggatgatgaaaattccaacttccttggaattgcctgctttgaaaagcttgcatcttatctctgtcacttttgttgcaaatgataatg |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
16910669 |
tggggtgtcccttggatgatgaaaattccaacttccttggaattgcctgctttgaaaagcttgcatcttatctctgccacttttgttgcaaatgacaatg |
16910768 |
T |
 |
| Q |
101 |
gcattgtggaacccttttcaaattttaagatgttaagcaccttggttcttgactgttggtgtctacaacacaatgcaactgtcctctgcatatctaattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16910769 |
gcattgtggaacccttttcaaattttaagatgttaagcactttggtccttaactgttggtctctacaacacaatgcaactgtcctctgcatatctaattc |
16910868 |
T |
 |
| Q |
201 |
caagctatatagtttgtccacaggtt |
226 |
Q |
| |
|
|||||||| |||||||| || ||||| |
|
|
| T |
16910869 |
caagctatctagtttgtgcataggtt |
16910894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University