View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_high_109 (Length: 317)
Name: NF1111_high_109
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_high_109 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 94 - 240
Target Start/End: Complemental strand, 42186963 - 42186818
Alignment:
| Q |
94 |
acttacttctagtatgagaaactcagtacctata--ggcatgaatcatgatgtcaactgcccataacaaactcatattattgattattcgatagatatcc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42186963 |
acttacttctagtatgagaaactcagtacctatataggcatgaatcatgatgtcaactgcccataacaaactcatattattgattattcgatagatatcc |
42186864 |
T |
 |
| Q |
192 |
cacataatttctatcctccacgctatataaaaaactacaattaaggcaa |
240 |
Q |
| |
|
||| |||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
42186863 |
cac---atttctatcctccacgctatataacaaactgcaattaaggcaa |
42186818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University