View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_high_125 (Length: 295)
Name: NF1111_high_125
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_high_125 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 59 - 273
Target Start/End: Complemental strand, 42038840 - 42038626
Alignment:
| Q |
59 |
gtacatgttcagtatcacactgactaagtgagtgactttgccacaatcacatgggctcaacgtgattctggcaaaaccaccgtgatatcagacacgtact |
158 |
Q |
| |
|
|||||||||||||||| || ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42038840 |
gtacatgttcagtatcccagtgactaagtcagtgactttgccacaatcacatcggctcaacgtgattctggcaaaaccactgtgatatcagacacgtact |
42038741 |
T |
 |
| Q |
159 |
tagtgtggttgtacctttgacattgccatgaccatagatgtgcaattgatccaacggtggaggaagctgtgatggatgacaattgtcatagtatggccaa |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038740 |
tagtgtggttgtacctttgacattgccatgaccatagatgtgcaattgatccaacggtggaggaagctgtgatggatgacaattgtcatagtatggccaa |
42038641 |
T |
 |
| Q |
259 |
gatgcaatggagttg |
273 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42038640 |
gatgcaatggagttg |
42038626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 42038930 - 42038845
Alignment:
| Q |
1 |
tatatgttaaattaatactaatatgatattattatgattgatgtgtgacaaagaatcggtacatgttcagtatcacactgactaag |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42038930 |
tatatgttaaattaatactaatatgatattattatgattgatgtgtgacaaagaatcggtacatgttcagtatcacagtgactaag |
42038845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University