View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_high_141 (Length: 280)
Name: NF1111_high_141
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_high_141 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 50 - 236
Target Start/End: Original strand, 7517452 - 7517631
Alignment:
| Q |
50 |
catgagaatgaggaagagaatagtatctgtgtcggggaaaggaaggtttaagggtatgattatccatattttcttctctttgagaaagaagaaaagtaga |
149 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7517452 |
catgagaatgaggaagagaatagtatttgtgtcgg-------aaggtttaagggtatgattatccagattttcttctctttgagaaagaagaaaagtaga |
7517544 |
T |
|
| Q |
150 |
tttgatgggcatggaagaagtgtgttagagtgaagttattatacgaaagaaggttggtttcaaggttttggaaaagagatggcaaca |
236 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7517545 |
tttaatgggcatggaagaagtgtgttagagtgaagttattatacgaaagaaggttggtttcaaggttttggaaaagagatggcaaca |
7517631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University