View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_high_181 (Length: 227)
Name: NF1111_high_181
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_high_181 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 42446444 - 42446226
Alignment:
| Q |
1 |
gaagggagagtacgaaaatcaccacatgtaataaataacatcactatcactattaattaataatggtatgcacgttgcatggcacaagtgttcccccacg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42446444 |
gaagggaaagtacgaaaatcaccacatgtaataaataacatcaccatcactattaattaataatggtatgcacgttgcatggcacaagtgttcccccacg |
42446345 |
T |
 |
| Q |
101 |
agcagcctataatacacagtggactctcactctaattcaattcagctctcgtgcaaagcatttctctcgcgcaacgcatttctctcgctacaaatgtaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42446344 |
agcagcctataatacacagtggactctcactctaattcaattcagctctcgtgcaaagcatttctctcgcgcaacgcatttctctcgctacaaatgtaac |
42446245 |
T |
 |
| Q |
201 |
aacctcattcatattcttc |
219 |
Q |
| |
|
| |||||||||| |||||| |
|
|
| T |
42446244 |
agcctcattcattttcttc |
42446226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University