View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_high_188 (Length: 214)
Name: NF1111_high_188
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_high_188 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 35342155 - 35341946
Alignment:
| Q |
1 |
gatcaacagaatttcgatcaaattatcatgtacaaaaacaagagcaagagcttgtttgtataatgtttcata-----tgatgtaaaattgaatacggtgt |
95 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35342155 |
gatcaatagaatttcgatcaaattatcatgtacaaaaacaagagcaagagcttgtttgtataatgtttcatactgtatgatgtaaaattgaatacggtgt |
35342056 |
T |
 |
| Q |
96 |
taattacactataggctatgtcaatgtcacgatgttattattttgttgaaatgaaacgtatttgcagaccnnnnnnnctttccctccataagaggcattg |
195 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
35342055 |
taattagaccataggctatgtcaatgtcacgatgttattattttgttgaaatgaaacgtatttgctgacctttttttctttccctccataagaggcattg |
35341956 |
T |
 |
| Q |
196 |
ccagaattat |
205 |
Q |
| |
|
|||| ||||| |
|
|
| T |
35341955 |
ccagcattat |
35341946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University