View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_102 (Length: 352)
Name: NF1111_low_102
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_102 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 8e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 85 - 255
Target Start/End: Original strand, 40103366 - 40103534
Alignment:
| Q |
85 |
aagaatataagtgtttcccctgttttaaatcgaaagtgtagagaaaaatgatgaatatgcggaaaaggagaaaaattgttgataaccctaacctgtgaag |
184 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40103366 |
aagaaaataagtgtttcccctgttttaaatcgaaagtgtagagaaaaatgatgaatatgcggaaaaggagaaaaattgttgataaccctaacctgtgaag |
40103465 |
T |
|
| Q |
185 |
gaggaggttgttgtcgttgcgagttgcttactgcggcgccgtaaggtggtgttttgccactccattgttgg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40103466 |
gaggaggttgttgtcgttgcgagttgcttactgcggcgccgtaaggtggtg--ttgccactccattgttgg |
40103534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University