View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_116 (Length: 335)
Name: NF1111_low_116
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_116 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 7e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 54 - 187
Target Start/End: Original strand, 15638743 - 15638874
Alignment:
| Q |
54 |
gatttgaagaaatgattgatagtcaaagaatccattgaaaaacaa--ttaagaaaatgcatttataagtttcttcctatcttttatcatccgtttatatg |
151 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15638743 |
gatttgaaaaaatgattgttagtcaaagaacccattgaaaaaaaaaattaagaaaatgcatttataagtttcttcctgtcttttatcatccgtttat--- |
15638839 |
T |
 |
| Q |
152 |
aatgaattggtagtagtcaaagtatattagcataaa |
187 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15638840 |
-atgaattagtagtagtcaaagtatattagcataaa |
15638874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 244 - 318
Target Start/End: Complemental strand, 48047566 - 48047492
Alignment:
| Q |
244 |
ttaaagcatttt-tggcttcagttctagctaaaaaaccaagctcgtgataatgtattgatactatgaaaatcaaca |
318 |
Q |
| |
|
||||||||| || |||||||||||||||||| |||||||||| | ||| ||||| |||||||||| |||| ||||| |
|
|
| T |
48047566 |
ttaaagcatgttctggcttcagttctagcta-aaaaccaagcccatgacaatgttttgatactataaaaaacaaca |
48047492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University