View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1111_low_116 (Length: 335)

Name: NF1111_low_116

Description: NF1111

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF1111_low_116

[»] chr7 (1 HSPs)

[»] chr3 (1 HSPs)

Target: chr7 (Bit Score: 84; Significance: 7e-40; HSPs: 1)

Name: chr7

Description:

Target: chr7; HSP #1

Raw Score: 84; E-Value: 7e-40

Query Start/End: Original strand, 54 - 187

Target Start/End: Original strand, 15638743 - 15638874

Alignment:

Q	54	gatttgaagaaatgattgatagtcaaagaatccattgaaaaacaa--ttaagaaaatgcatttataagtttcttcctatcttttatcatccgtttatatg	151	Q
		\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\| \|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	15638743	gatttgaaaaaatgattgttagtcaaagaacccattgaaaaaaaaaattaagaaaatgcatttataagtttcttcctgtcttttatcatccgtttat---	15638839	T

Q	152	aatgaattggtagtagtcaaagtatattagcataaa	187	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	15638840	-atgaattagtagtagtcaaagtatattagcataaa	15638874	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)

Name: chr3

Description:

Target: chr3; HSP #1

Raw Score: 32; E-Value: 0.000000007

Query Start/End: Original strand, 244 - 318

Target Start/End: Complemental strand, 48047566 - 48047492

Alignment:

Q	244	ttaaagcatttt-tggcttcagttctagctaaaaaaccaagctcgtgataatgtattgatactatgaaaatcaaca	318	Q
		\|\|\|\|\|\|\|\|\| \|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \| \|\|\| \|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\|\| \|\|\|\|\|
T	48047566	ttaaagcatgttctggcttcagttctagcta-aaaaccaagcccatgacaatgttttgatactataaaaaacaaca	48047492	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]