View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_117 (Length: 334)
Name: NF1111_low_117
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_117 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 7 - 318
Target Start/End: Complemental strand, 25151371 - 25151064
Alignment:
| Q |
7 |
aaaacaaacagaaaatagagtgtgagttgagagagtagctagtgcccctaatagaagaaggtttgcaatgtcacgtttttgcctcttaagggattaaaag |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25151371 |
aaaacaaacagaaaatagagtg--agttgagag--tagctagtgtccctaatagaagaaggtttgcaatgtcacgtttttgcctcttaatggattaaaag |
25151276 |
T |
|
| Q |
107 |
tggcagtgacagataacatagttgggatggaaaacgatatttgtttcctcgtaaaagtggatgttattattgcgatgttgtcttttattttcttaaatca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25151275 |
tggcagtgacagataacatagttgggatggaaaacgatatttgtttcctcgtaaaagtggatgttattattgcgatgttgtcttttattttctttaatca |
25151176 |
T |
|
| Q |
207 |
agttttggtctaaaccaactagatatgaaagggatatcaaactgttaagtttcaatgcaagggaaatgaatgtaggttacaccaaaaaggaagttcgtga |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25151175 |
agttttggtctaaaccaactagatatgaaagggatatcaaactgttaggtttcaatgcaagggaaatgaatgtaggttacaccaaaaaggaagttcgtga |
25151076 |
T |
|
| Q |
307 |
tgaatgatgatg |
318 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25151075 |
tgaatgatgatg |
25151064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University