View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_124 (Length: 328)
Name: NF1111_low_124
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_124 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 5549123 - 5548892
Alignment:
| Q |
1 |
tctagaggtggagatatgttccactttgaacctacaccttcatgtgtgtaatatcttggtaatttgacacctccttctttgtcaattgctggtgaaacca |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5549123 |
tctagaggtggagatatattccactttgaacctacgccttcatgtgtgtaatatcttggtaatttgacacctccttctttgtcaattgctggtgaaacca |
5549024 |
T |
 |
| Q |
101 |
acctgaattctttgctagccatggatagcaaagtaaatatgcttattatttgtgcactttgttgcgtaattttgcaaatgctataattgattcatttgcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
5549023 |
acctgaattctttgctagccatggatagcaatgtaaatatgcttactatttgtgcactttgttgcgt-attttgcaaatgctataattgattaatttgcg |
5548925 |
T |
 |
| Q |
201 |
gtgtgtttgtataagttcatgtctataaatgatga |
235 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||| |
|
|
| T |
5548924 |
ttgggtttg--taagttcatgtctataaatgatga |
5548892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University