View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_136 (Length: 322)
Name: NF1111_low_136
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_136 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 101 - 242
Target Start/End: Complemental strand, 34349690 - 34349549
Alignment:
| Q |
101 |
ataagtctatatgtgttattttctaacttattttaatagtgtattagtttctaacttataagtctatatgtgagttaactaaatctataagtctacatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34349690 |
ataagtctatatgtgttattttctaacttattttaatagtgtattagtttctaacttataagtctatatgtgagttaactaaatctataagtctacatgg |
34349591 |
T |
 |
| Q |
201 |
acccttgtaaaatgcattgcagatatgaagatgatgcctatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34349590 |
acccttgtaaaatgcattgcagatatgaagatgatgcctatg |
34349549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 140 - 172
Target Start/End: Complemental strand, 34349708 - 34349676
Alignment:
| Q |
140 |
tgtattagtttctaacttataagtctatatgtg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34349708 |
tgtattagtttctaacttataagtctatatgtg |
34349676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University