View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_139 (Length: 319)
Name: NF1111_low_139
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_139 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 84 - 221
Target Start/End: Original strand, 49106119 - 49106256
Alignment:
| Q |
84 |
caacaaaatatatatgacaagggtttggcttatggataagtacataacatgggatttccttacacaaactagtaataaattgagcacattgtgnnnnnnn |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
49106119 |
caacaaaatatatatgacaagggtttggcttatggataagtgcataacatgggatttccttccacaaactagtaataaattgagcacattatgttttttt |
49106218 |
T |
 |
| Q |
184 |
atgagtcctgacttgaactcacacatgcatgtgcatat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49106219 |
atgagtcctgacttgaactcacacatgcatgtgcatat |
49106256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University