View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1111_low_140 (Length: 318)

Name: NF1111_low_140
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1111_low_140
NF1111_low_140
[»] chr6 (1 HSPs)
chr6 (100-245)||(32204140-32204285)


Alignment Details
Target: chr6 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 100 - 245
Target Start/End: Complemental strand, 32204285 - 32204140
Alignment:
100 acttattcccatttcacagcctatatgtgcgagtataatgcgattaagttcgttcacttccactaaatgaagattatttagaagccacaagtattgtgta 199  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32204285 acttattcccatttcacagcctatatgtgcaagtataatgcgattaagttcgttcacttccactaaatgaagattatttagaagccacaagtattgtgta 32204186  T
200 atattactactagggtaatacttttatgtaatggaacctatgctac 245  Q
    |||||||||||||| ||||||||||||||||||||| |||||||||    
32204185 atattactactaggataatacttttatgtaatggaatctatgctac 32204140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University