View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_142 (Length: 318)
Name: NF1111_low_142
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_142 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 10 - 235
Target Start/End: Original strand, 33915460 - 33915688
Alignment:
| Q |
10 |
cacaacttcctcgattatgcaaaataaaagtggagataagggatcagcttagaatactcccctagtgcaatgaaataaaattgtagcttttccattaatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33915460 |
cacaacttcctcgattatgcaaaataaaagtggagataagggatcagcttagaatactcccttagtgcaatgaaataaaattgtagcttttccattaatg |
33915559 |
T |
 |
| Q |
110 |
ataatgattaacgagattttagcaaaattaaggatgg---caacacagtttcatgaaacaagattgaaactaaaatccatttgactcaagatctatcttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33915560 |
ataatgattaacgagattttagcaaaattaaggatggcatcaacacagtttcatgatacaagattgaaactaaaagccatttgactcaagatctatcttt |
33915659 |
T |
 |
| Q |
207 |
ccaagatgtctcctagtagttgagagcaa |
235 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33915660 |
ccaagatgtctcctagtagttgagagcaa |
33915688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University