View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_149 (Length: 315)
Name: NF1111_low_149
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_149 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 36382710 - 36382942
Alignment:
| Q |
1 |
ctttggacaggtccaatatcaaatgcatctctggatgttgtccaaggtggtcgatctgtcgaggtccgtgcagttggtgtgtcaaaggtatacaaaattc |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36382710 |
ctttggacaggcccaatatcaaatgcatctcttgatgttgtccaaggtggtcgatctgtcgaggtccgtgcagttggtgtgtcaaaggtatacaaaattc |
36382809 |
T |
|
| Q |
101 |
cagttggctagtacacatttctattaggcttttttattcggaaaattt------------tataagacctaacactcgttttttggctttcctactatgt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36382810 |
cagttggctagtacacatttctattaggcttttttattcggaaaattttcttctatatactataagacctaacactcgttttttggctttcctactatgt |
36382909 |
T |
|
| Q |
189 |
attttgatgtagggagcagctattgatcgtatc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36382910 |
attttgatgtagggagcagctattgatcgtatc |
36382942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University