View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_151 (Length: 312)
Name: NF1111_low_151
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_151 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 4e-78; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 88 - 239
Target Start/End: Original strand, 37742606 - 37742757
Alignment:
| Q |
88 |
gttgctgctgtggttagctttgcattgttggtgtttggaggagttggtgcattggttggaaaaactcctttgatgaggtcttgtgttagagttcttattg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37742606 |
gttgctgctgtggttagctttgcattgttggtgtttggaggagttggtgcattggttggaaaaactcctttgatgaggtcttgtgttagagttcttattg |
37742705 |
T |
 |
| Q |
188 |
gaggttggatggctatggctattacttttggtttcactaaattgattggcaa |
239 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37742706 |
gaggttggatggctatggccattacttttggtttcactaaattgattggcaa |
37742757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 88 - 239
Target Start/End: Original strand, 37749676 - 37749827
Alignment:
| Q |
88 |
gttgctgctgtggttagctttgcattgttggtgtttggaggagttggtgcattggttggaaaaactcctttgatgaggtcttgtgttagagttcttattg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37749676 |
gttgctgctgtggttagctttgcattgttggtgtttggaggagttggtgcattggttggaaaaactcctttgatgaggtcttgtgttagagttcttattg |
37749775 |
T |
 |
| Q |
188 |
gaggttggatggctatggctattacttttggtttcactaaattgattggcaa |
239 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37749776 |
gaggttggatggctatggccattacttttggtttcactaaattgattggcaa |
37749827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 88 - 238
Target Start/End: Complemental strand, 37752112 - 37751962
Alignment:
| Q |
88 |
gttgctgctgtggttagctttgcattgttggtgtttggaggagttggtgcattggttggaaaaactcctttgatgaggtcttgtgttagagttcttattg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37752112 |
gttgctgctgtggttagctttgcattgttggtgtttggaggagttggtgcattggttggaaaaactcctttgatgaggtcttgtgttagagttcttattg |
37752013 |
T |
 |
| Q |
188 |
gaggttggatggctatggctattacttttggtttcactaaattgattggca |
238 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
37752012 |
gaggttggatggctatggccattacttttggtttcaccaaattgattggca |
37751962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 165 - 218
Target Start/End: Complemental strand, 37733134 - 37733081
Alignment:
| Q |
165 |
gtcttgtgttagagttcttattggaggttggatggctatggctattacttttgg |
218 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||| ||||| |
|
|
| T |
37733134 |
gtcttgtgttagagtggtggttggaggttggatggctatggctattacctttgg |
37733081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University