View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_155 (Length: 308)
Name: NF1111_low_155
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_155 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 64 - 261
Target Start/End: Original strand, 37558380 - 37558577
Alignment:
| Q |
64 |
aagagccctgaagttcttaagaaggatgaaaagaagagcactcaaggtcttaatctaaagaaggatgacaagatgcctggtgtggatggtgacgactacg |
163 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37558380 |
aagagcactgaagttcttaagaaggatgaaaagaagagcactcaaggtcttaatctaaagaaggatgacaagatgcctggtgtggatggtgacgactatg |
37558479 |
T |
|
| Q |
164 |
gtgtaacttcgcaacctctaccaaattattcttttgtcaacaatgcagctgtggagttggctttcaaaatgactgaaaaatcactcaaggatcccttc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37558480 |
gtgtaacttcgcaacctctaccaaattattcttttgtcaacaatgcagctgtggagttggctttcaaaatgactgaaaaatcactcaaggatcccttc |
37558577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 37558347 - 37558399
Alignment:
| Q |
64 |
aagagccctgaagttcttaagaaggatgaaaagaagagcactcaaggtcttaa |
116 |
Q |
| |
|
|||||| |||||| |||||||||||||||| ||||||||||| ||| |||||| |
|
|
| T |
37558347 |
aagagcactgaagatcttaagaaggatgaacagaagagcactgaagttcttaa |
37558399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 168 - 257
Target Start/End: Original strand, 41553803 - 41553892
Alignment:
| Q |
168 |
aacttcgcaacctctaccaaattattcttttgtcaacaatgcagctgtggagttggctttcaaaatgactgaaaaatcactcaaggatcc |
257 |
Q |
| |
|
|||||| ||| ||||| ||||||| ||||||||||||| |||||| | ||| ||||||||||||||||| |||||| || ||||||||| |
|
|
| T |
41553803 |
aacttcacaagctctatcaaattactcttttgtcaacagtgcagcagcggacttggctttcaaaatgacagaaaaaacatccaaggatcc |
41553892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 261
Target Start/End: Complemental strand, 4444886 - 4444789
Alignment:
| Q |
164 |
gtgtaacttcgcaacctctaccaaattattcttttgtcaacaatgcagctgtggagttggctttcaaaatgactgaaaaatcactcaaggatcccttc |
261 |
Q |
| |
|
||||||||| |||||||||| ||||||| |||||||||||||| ||||| | | ||||||| |||||||||||||| || ||||| |||||||| |
|
|
| T |
4444886 |
gtgtaactttgcaacctctaacaaattactcttttgtcaacaacgcagccgcaaacgtggcttttgaaatgactgaaaaaacattcaagaatcccttc |
4444789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University