View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_160 (Length: 301)
Name: NF1111_low_160
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_160 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 67 - 249
Target Start/End: Original strand, 30306541 - 30306723
Alignment:
| Q |
67 |
ttgccctttttcaaatgccttctgttaaattactgtttcccataaatggtcaattttccatttcatacatatgaaatagggtgccagcttgtttcttctt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30306541 |
ttgccctttttcaaatgccttctgttaaattactgtttcccataaatggtcaattttccatttcatacatatgaaatagggtgccagcttgttttttctt |
30306640 |
T |
|
| Q |
167 |
gtggttacttctgcatcatagttatctggacttgtaactttgttatggtgttgtacaacaactgacatgttcatctcactcga |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30306641 |
gtggttacttctgcatcatagttatctggacttgtaactttgttatggtgttgtacaacaactgacatgtttttctcactcga |
30306723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 100 - 206
Target Start/End: Original strand, 30328354 - 30328466
Alignment:
| Q |
100 |
tgtttcccataaatggtcaattttccatttcatacatatgaaatagggtgccagcttgtttcttcttgtgg---ttac---ttctgcatcatagttatct |
193 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||| ||||||||||||| |||| |||||||||||||||| |||| | ||||| |||||||||| |
|
|
| T |
30328354 |
tgttttccataaatggtcaattttccatctcatacgtatgaaatagggtaccagtttgtttcttcttgtggatattacatttactgcaaaatagttatct |
30328453 |
T |
|
| Q |
194 |
ggacttgtaactt |
206 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30328454 |
ggacttgtaactt |
30328466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University