View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_170 (Length: 294)
Name: NF1111_low_170
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_170 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 30 - 284
Target Start/End: Complemental strand, 33523618 - 33523361
Alignment:
| Q |
30 |
ataagtagttggaggatgagatcctcaacatgttaatttcaaaaatcatgtattaaaaggctcaaaatttaggaaacgatcatctcggaaagaggatgga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33523618 |
ataagtagttggaggatgagatcctcaacatgttaatttcaaaaatcatgtattaaaaggctcaaaatttaggaaacgatcatctcggaaagaggatgga |
33523519 |
T |
 |
| Q |
130 |
attaatgttgccatcgttgtggaatttcaaattccacaaggaagaagaaagagaagggatggatgcttgcat---gttgagtaatgaaaaacacaaatat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33523518 |
attaatgttgccatcgttgtggaatttcaaattccacaaggaagaagaaagagaagggatggatgcttgcatgttgttgagtaatgaaaaacacaaatat |
33523419 |
T |
 |
| Q |
227 |
ggatggttttcaacccaaaatatgtgattttgtgatttttgaatctcttgctcctatg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33523418 |
ggatggttttcaacccaaaatatgtgattttgtgatttttgaatctcttgctcctatg |
33523361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University