View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1111_low_170 (Length: 294)

Name: NF1111_low_170
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1111_low_170
NF1111_low_170
[»] chr1 (1 HSPs)
chr1 (30-284)||(33523361-33523618)


Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 30 - 284
Target Start/End: Complemental strand, 33523618 - 33523361
Alignment:
30 ataagtagttggaggatgagatcctcaacatgttaatttcaaaaatcatgtattaaaaggctcaaaatttaggaaacgatcatctcggaaagaggatgga 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33523618 ataagtagttggaggatgagatcctcaacatgttaatttcaaaaatcatgtattaaaaggctcaaaatttaggaaacgatcatctcggaaagaggatgga 33523519  T
130 attaatgttgccatcgttgtggaatttcaaattccacaaggaagaagaaagagaagggatggatgcttgcat---gttgagtaatgaaaaacacaaatat 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||    
33523518 attaatgttgccatcgttgtggaatttcaaattccacaaggaagaagaaagagaagggatggatgcttgcatgttgttgagtaatgaaaaacacaaatat 33523419  T
227 ggatggttttcaacccaaaatatgtgattttgtgatttttgaatctcttgctcctatg 284  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33523418 ggatggttttcaacccaaaatatgtgattttgtgatttttgaatctcttgctcctatg 33523361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University