View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_172 (Length: 292)
Name: NF1111_low_172
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_172 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 4 - 234
Target Start/End: Complemental strand, 40560018 - 40559788
Alignment:
| Q |
4 |
attctgcgacaaaatcattaagcttgcgattgcttgagctgcaagttttctttcaccgtttgctttagactcaagcatgttgataagtagagggatgcaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40560018 |
attctgcgacaaaatcattaagcttgcgattgcttgagctgcaagttttctttcaccgtttgctttagactcaagcatgttgataagtagagggatgcaa |
40559919 |
T |
 |
| Q |
104 |
taaaatacgcggcggctggttgagcatctaatgatctacacttcaacacatgaactaaaatagaaagcaaatccaagagaaattaaaccaaagtttccgc |
203 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40559918 |
caaaatacgcggcggcttgttgagcatctaatgatctacacttcaacacatgaactaaactataaagcaaattcaagagaaattaaaccaaagtttccgc |
40559819 |
T |
 |
| Q |
204 |
agaaaccgacccaactagattccccaatgca |
234 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |
|
|
| T |
40559818 |
agaaatcgacccaactagattccccaatgca |
40559788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 103
Target Start/End: Original strand, 12484165 - 12484264
Alignment:
| Q |
4 |
attctgcgacaaaatcattaagcttgcgattgcttgagctgcaagttttctttcaccgtttgctttagactcaagcatgttgataagtagagggatgcaa |
103 |
Q |
| |
|
|||||| ||||||||||| || || || |||||||| |||||||||| ||| || ||||||||||| ||||||||||||||| | |||||| |||||| |
|
|
| T |
12484165 |
attctgagacaaaatcatcaaactggcaattgcttgtgctgcaagttctctagcagtgtttgctttagcctcaagcatgttgatcaatagaggaatgcaa |
12484264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University