View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_178 (Length: 288)
Name: NF1111_low_178
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_178 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 3 - 245
Target Start/End: Complemental strand, 26662526 - 26662284
Alignment:
| Q |
3 |
aacgaacttttgttggaattcaagaagaaaacactttcatgaaaaggtgaaaattctgtctacaaaacacggcaggacgataaggaaactgtctgtggat |
102 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26662526 |
aacgaacttttgtcggaattcaagaagaaaacactttcatgaaaaggtgaaaattctgtctagaaaacacggcaggacgataaggaaactgtttgtggat |
26662427 |
T |
 |
| Q |
103 |
gatgttgattgggattgattttccctcaataattgattttaacttgtaactaggagcttttgacttcagatatgatttttatactcaaatttgatgtttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26662426 |
gatgttgattgggattgattttccctcaataattgattttaacttgtaactaggagcttttgacttcaaatatgatttttatactcaaatttgatgtttt |
26662327 |
T |
 |
| Q |
203 |
gcttgtttgactacctttcttaattgtgtttactttattggtt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26662326 |
gcttgtttgactacctttcttaattgtgtttactttattggtt |
26662284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University