View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_181 (Length: 285)
Name: NF1111_low_181
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_181 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 55 - 240
Target Start/End: Complemental strand, 35551255 - 35551070
Alignment:
| Q |
55 |
acatcatcacaaagccatattggactgtctgcaaacatctgtaacttaattgtagtatagtgtggttgattacgtgctgtaaggagcaaagtccttgctt |
154 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35551255 |
acatgatcacaaagccatattggactgtctgcaaacatctgtaacttaattgtagtattgtgtggttgattacgtgctgtaagaagcaaagtccttgctt |
35551156 |
T |
|
| Q |
155 |
ttatttattggttcaagggggatggttgttttgattgtcaaaagtatagaaccaatcttttgtgacagtatatttctgcaacagct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35551155 |
ttatttattggttcaagggggatggttgttttgattgtcaaaagtatagagccaatcttttgtgacagtatatttctgcaacagct |
35551070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University