View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_183 (Length: 285)
Name: NF1111_low_183
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_183 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 45 - 236
Target Start/End: Complemental strand, 39007364 - 39007173
Alignment:
| Q |
45 |
aagtaaaacttcagaaagagaaaatcatgaaaaaggtgctggtataatggataaagtaaaaaattatataaaacaacgggagaccaacagacagactaaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39007364 |
aagtaaaacttcagaaagagaaaatcatgaaaaaggtgctgatataatggataaagtaaaaaattatataaaacaacgggagaccaacacacagactaaa |
39007265 |
T |
 |
| Q |
145 |
atttttatcatgaaaaaagatcaatatcaaaaagaattataacatatcaggtcttcaacttccaaaaactttatagccatatagttgcaaca |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39007264 |
atttttatcatgaaaaaagatcaatatcaaaaagaattataacatatcaggtcttcaacttccaaaaacttcatagccatatagttgcaaca |
39007173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University