View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_190 (Length: 277)
Name: NF1111_low_190
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_190 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 50 - 238
Target Start/End: Complemental strand, 18635020 - 18634832
Alignment:
| Q |
50 |
atggaagagggtaatgtgtcattcattacacaccagactacagaggacactaagctatgctagatttattacatcaccaatagtctctttaatccccatc |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18635020 |
atggaagagggtaatgtgtcattcattacacaccagactacagaggacactaagctatgctagatttattacatcaccaatagtctctttaatccccatc |
18634921 |
T |
 |
| Q |
150 |
actagactaatgaaacataaggtaatttttaagatgcaatgttggtacctgcttattgccccttgacccaagatgaggtgtagcaacag |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18634920 |
tctagactaatgaaacataaggtaacttttaagatgcaatgttggtacctgcttattgccccttgacccaagatgaggtgtagcaacag |
18634832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University