View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_193 (Length: 275)
Name: NF1111_low_193
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_193 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 32 - 230
Target Start/End: Complemental strand, 35696607 - 35696409
Alignment:
| Q |
32 |
tgagatgaatagcgacagttccaatgagaacatcacggagccaagcagaggcatagatttcaatcataatgacagactcttctgataggaggaaatcatc |
131 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696607 |
tgagatgaacagcgacagttccaatgagaacatcacggagccaagcagaggcatagatttcaatcataatgacagactcttctgataggaggaaatcatc |
35696508 |
T |
|
| Q |
132 |
gtcgacgcggaaaacaaatttttcattccaggtagggttgttatgaccatgagggtctgcttgggtggtaagtttacgttctggattgagccatgcaac |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696507 |
gtcgacgcggaaaacaaatttttcattccaggtagggttgttatgaccatgagggtctgcttgggtggtaagtttacgttctggattgagccatgcaac |
35696409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 161
Target Start/End: Original strand, 47725460 - 47725572
Alignment:
| Q |
49 |
gttccaatgagaacatcacggagccaagcagaggcatagatttcaatcataatgacagactcttctgataggaggaaatcatcgtcgacgcggaaaacaa |
148 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||| || ||||| |||||| ||| || |||| |||||||||||||||| |
|
|
| T |
47725460 |
gttccaatgagaatatcacggagccaagcagaattgtagatttcaatcatgataacagaactttctgaattgagaaattcattatcgacgcggaaaacaa |
47725559 |
T |
|
| Q |
149 |
atttttcattcca |
161 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
47725560 |
atttctcattcca |
47725572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University