View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_194 (Length: 275)
Name: NF1111_low_194
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_194 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 53 - 240
Target Start/End: Complemental strand, 10353247 - 10353060
Alignment:
| Q |
53 |
ttacctcaggatgcagattataatctcagtctcagcgacgagctagagacatcgatcttggcgagatttccaagatcacaacattggaaactatcttttc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10353247 |
ttacctcaggatgcagattataatctcagtctcagcgacgagctagagacatcgatcttggcgagatttccaagatcacaacattggaaactatcttttc |
10353148 |
T |
|
| Q |
153 |
taaacaagagatttttaactctgatgaaaagtggcgagatctataaaatacggaaagagttaggacttaaagaaccatccgttttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10353147 |
taaacaagagatttttaactctgatgaaaagtggcgagatctataaaatacggaaagagttaggacttaaagaaccatccgttttcat |
10353060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University