View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1111_low_203 (Length: 271)

Name: NF1111_low_203
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1111_low_203
NF1111_low_203
[»] chr3 (9 HSPs)
chr3 (1-116)||(23139820-23139935)
chr3 (1-111)||(23148537-23148647)
chr3 (1-81)||(23145729-23145809)
chr3 (216-271)||(24281584-24281639)
chr3 (1-95)||(23038836-23038930)
chr3 (1-96)||(23016856-23016951)
chr3 (1-96)||(23035964-23036059)
chr3 (6-53)||(23032551-23032598)
chr3 (1-85)||(23024077-23024161)
[»] chr6 (1 HSPs)
chr6 (1-109)||(21779594-21779702)
[»] scaffold0554 (1 HSPs)
scaffold0554 (1-80)||(6865-6944)


Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 9)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 23139935 - 23139820
Alignment:
1 tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagcttaact 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
23139935 tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatgtgagcttaact 23139836  T
101 agaagatactgttagt 116  Q
    ||||||||||||||||    
23139835 agaagatactgttagt 23139820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 23148647 - 23148537
Alignment:
1 tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagcttaact 100  Q
    |||||||||| |||||||||||| || | ||||| ||||||||||||||||||||||  |||||||||| |||||||||||  || | |||||||| |||    
23148647 tggatatgactgaggaatttggactcacggtgaggagaaaagatgatcttttattgtgcccttttgtttatcatcctttgcaagttacatgagcttcact 23148548  T
101 agaagatactg 111  Q
    |||||| ||||    
23148547 agaagaaactg 23148537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 23145809 - 23145729
Alignment:
1 tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgc 81  Q
    |||||||||| |||||||||||| || | ||||||||||||||||||||||||||||  |||||||||| | |||||||||    
23145809 tggatatgactgaggaatttggactcacggtgagaagaaaagatgatcttttattgtgcccttttgtttataatcctttgc 23145729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 271
Target Start/End: Original strand, 24281584 - 24281639
Alignment:
216 atataagattcaacatcacgtgttatctcaaatttaaacacatgaatcaatcacca 271  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||| |||||    
24281584 atataagattcaacatcacttgttatctcaaatttaaacacatgaatcaaccacca 24281639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 23038930 - 23038836
Alignment:
1 tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagct 95  Q
    |||||||||| || ||||| |||| | || ||||||||||||||||||||||||||||  ||||||||| ||||||||||   ||||||||||||    
23038930 tggatatgactgatgaattcggagccacaatgagaagaaaagatgatcttttattgttttcttttgtttatcatcctttgtaagtcatatgagct 23038836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 23016951 - 23016856
Alignment:
1 tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagctt 96  Q
    |||| ||||| ||| ||||||||||| || |||| ||||||||||| |||||| | ||||||||||||| ||||||||||  ||||| ||||||||    
23016951 tggacatgactgagcaatttggagtcacaatgaggagaaaagatgaccttttactattgccttttgtttatcatcctttgaatgtcagatgagctt 23016856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 23036059 - 23035964
Alignment:
1 tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagctt 96  Q
    |||| ||||| || |||||||||| | || |||||||||| ||||| |||||||||||  ||| ||||| ||||||| ||| ||||||||||||||    
23036059 tggacatgactgacgaatttggagccacaatgagaagaaaggatgaacttttattgttttcttctgtttatcatcctctgcatgtcatatgagctt 23035964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 53
Target Start/End: Complemental strand, 23032598 - 23032551
Alignment:
6 atgaccgaggaatttggagtcgcagtgagaagaaaagatgatctttta 53  Q
    ||||| |||||||||||| ||||| |||||||||||||||||||||||    
23032598 atgactgaggaatttggaatcgcaatgagaagaaaagatgatctttta 23032551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 23024161 - 23024077
Alignment:
1 tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgt 85  Q
    |||| ||||| ||| |||||||  || ||||| | |||||||||||||| |||||||| |||| ||||| ||||| |||||||||    
23024161 tggacatgactgagaaatttggtatcacagtgtgtagaaaagatgatctattattgttaccttctgtttatcatcatttgcctgt 23024077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 21779702 - 21779594
Alignment:
1 tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagcttaact 100  Q
    |||| ||||| |||||||| |||||| || ||| ||||||| | ||||||||| |||| |||||   || ||||||||| || |||||| ||||||| ||    
21779702 tggacatgactgaggaattcggagtcacaatgaaaagaaaaaacgatcttttagtgttacctttatcttatcatcctttccccgtcatacgagcttagct 21779603  T
101 agaagatac 109  Q
    |||||||||    
21779602 agaagatac 21779594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0554 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0554
Description:

Target: scaffold0554; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 6865 - 6944
Alignment:
1 tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttg 80  Q
    |||| ||||| ||||||||||||||  || |||||||||| |||||||||| |||||| || | ||||| ||||||||||    
6865 tggacatgacagaggaatttggagttacaatgagaagaaaggatgatctttcattgtttccctctgtttatcatcctttg 6944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University