View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_203 (Length: 271)
Name: NF1111_low_203
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_203 |
 | |
|
| [»] scaffold0554 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 23139935 - 23139820
Alignment:
| Q |
1 |
tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagcttaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23139935 |
tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatgtgagcttaact |
23139836 |
T |
|
| Q |
101 |
agaagatactgttagt |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23139835 |
agaagatactgttagt |
23139820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 23148647 - 23148537
Alignment:
| Q |
1 |
tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagcttaact |
100 |
Q |
| |
|
|||||||||| |||||||||||| || | ||||| |||||||||||||||||||||| |||||||||| ||||||||||| || | |||||||| ||| |
|
|
| T |
23148647 |
tggatatgactgaggaatttggactcacggtgaggagaaaagatgatcttttattgtgcccttttgtttatcatcctttgcaagttacatgagcttcact |
23148548 |
T |
|
| Q |
101 |
agaagatactg |
111 |
Q |
| |
|
|||||| |||| |
|
|
| T |
23148547 |
agaagaaactg |
23148537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 23145809 - 23145729
Alignment:
| Q |
1 |
tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgc |
81 |
Q |
| |
|
|||||||||| |||||||||||| || | |||||||||||||||||||||||||||| |||||||||| | ||||||||| |
|
|
| T |
23145809 |
tggatatgactgaggaatttggactcacggtgagaagaaaagatgatcttttattgtgcccttttgtttataatcctttgc |
23145729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 216 - 271
Target Start/End: Original strand, 24281584 - 24281639
Alignment:
| Q |
216 |
atataagattcaacatcacgtgttatctcaaatttaaacacatgaatcaatcacca |
271 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24281584 |
atataagattcaacatcacttgttatctcaaatttaaacacatgaatcaaccacca |
24281639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 23038930 - 23038836
Alignment:
| Q |
1 |
tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagct |
95 |
Q |
| |
|
|||||||||| || ||||| |||| | || |||||||||||||||||||||||||||| ||||||||| |||||||||| |||||||||||| |
|
|
| T |
23038930 |
tggatatgactgatgaattcggagccacaatgagaagaaaagatgatcttttattgttttcttttgtttatcatcctttgtaagtcatatgagct |
23038836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 23016951 - 23016856
Alignment:
| Q |
1 |
tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagctt |
96 |
Q |
| |
|
|||| ||||| ||| ||||||||||| || |||| ||||||||||| |||||| | ||||||||||||| |||||||||| ||||| |||||||| |
|
|
| T |
23016951 |
tggacatgactgagcaatttggagtcacaatgaggagaaaagatgaccttttactattgccttttgtttatcatcctttgaatgtcagatgagctt |
23016856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 23036059 - 23035964
Alignment:
| Q |
1 |
tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagctt |
96 |
Q |
| |
|
|||| ||||| || |||||||||| | || |||||||||| ||||| ||||||||||| ||| ||||| ||||||| ||| |||||||||||||| |
|
|
| T |
23036059 |
tggacatgactgacgaatttggagccacaatgagaagaaaggatgaacttttattgttttcttctgtttatcatcctctgcatgtcatatgagctt |
23035964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 6 - 53
Target Start/End: Complemental strand, 23032598 - 23032551
Alignment:
| Q |
6 |
atgaccgaggaatttggagtcgcagtgagaagaaaagatgatctttta |
53 |
Q |
| |
|
||||| |||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
23032598 |
atgactgaggaatttggaatcgcaatgagaagaaaagatgatctttta |
23032551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 23024161 - 23024077
Alignment:
| Q |
1 |
tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgt |
85 |
Q |
| |
|
|||| ||||| ||| ||||||| || ||||| | |||||||||||||| |||||||| |||| ||||| ||||| ||||||||| |
|
|
| T |
23024161 |
tggacatgactgagaaatttggtatcacagtgtgtagaaaagatgatctattattgttaccttctgtttatcatcatttgcctgt |
23024077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 21779702 - 21779594
Alignment:
| Q |
1 |
tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttgcctgtcatatgagcttaact |
100 |
Q |
| |
|
|||| ||||| |||||||| |||||| || ||| ||||||| | ||||||||| |||| ||||| || ||||||||| || |||||| ||||||| || |
|
|
| T |
21779702 |
tggacatgactgaggaattcggagtcacaatgaaaagaaaaaacgatcttttagtgttacctttatcttatcatcctttccccgtcatacgagcttagct |
21779603 |
T |
|
| Q |
101 |
agaagatac |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
21779602 |
agaagatac |
21779594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0554 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0554
Description:
Target: scaffold0554; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 6865 - 6944
Alignment:
| Q |
1 |
tggatatgaccgaggaatttggagtcgcagtgagaagaaaagatgatcttttattgttgccttttgtttgtcatcctttg |
80 |
Q |
| |
|
|||| ||||| |||||||||||||| || |||||||||| |||||||||| |||||| || | ||||| |||||||||| |
|
|
| T |
6865 |
tggacatgacagaggaatttggagttacaatgagaagaaaggatgatctttcattgtttccctctgtttatcatcctttg |
6944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University