View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_208 (Length: 266)
Name: NF1111_low_208
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_208 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 9 - 183
Target Start/End: Complemental strand, 7361895 - 7361721
Alignment:
| Q |
9 |
cttctctcttgccagtgaccttcaccttcttcgcttcctcgttcatcaacctagattttggtgactctgtcttccttccacttatagcttcatcaaccac |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7361895 |
cttctctcttgcccgtgaccttcaccttcttcgcttcctccttcatcaacctagattttggtgactctgtcttccttccacttatagcttcatcaaccac |
7361796 |
T |
 |
| Q |
109 |
tatgtcttcctaaacatgtatggtacttttcctctctttctccccaagacattgatgttccatatcaacatcttc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7361795 |
tatgtcttcctaaacatgtatggtacttttcctctctttctccccaagacattgatgttccatatcaacatcttc |
7361721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University