View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_210 (Length: 266)
Name: NF1111_low_210
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_210 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 77 - 191
Target Start/End: Complemental strand, 1165087 - 1164973
Alignment:
| Q |
77 |
aatactttctgtactgttcatattgatgatctcaagtgctcaagctttgaaccaccatgatgggttcacggaaagtcggaatgatcacaaacatgaacta |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1165087 |
aatactttctgtactgttcatattgatgatctcaagtgctcaagctttgaaccaccatgatgggttcgcggaaagtcggaatgatcacaaacatgaacta |
1164988 |
T |
|
| Q |
177 |
tctcttcctataaga |
191 |
Q |
| |
|
|| | | |||||||| |
|
|
| T |
1164987 |
tcccatactataaga |
1164973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 77 - 191
Target Start/End: Complemental strand, 1172445 - 1172331
Alignment:
| Q |
77 |
aatactttctgtactgttcatattgatgatctcaagtgctcaagctttgaaccaccatgatgggttcacggaaagtcggaatgatcacaaacatgaacta |
176 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1172445 |
aatactttctgtactcttcctattgatgatctcaagtgctcaagctttgaaccaaaacgatgggttcgtggaaagtcggaatgatcacaaacatgaacta |
1172346 |
T |
|
| Q |
177 |
tctcttcctataaga |
191 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
1172345 |
tctcttactataaga |
1172331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University