View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_215 (Length: 257)
Name: NF1111_low_215
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_215 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 43948542 - 43948338
Alignment:
| Q |
13 |
gagatgga-catcatcacaaggttataaaaagatgaaagaatggaagtcaaatataaggatacaaaccggtannnnnnn-agaaacagacaggaataaac |
110 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43948542 |
gagatggagcattatcacaaggttataaaaagatgaaagaatggaagtcaaatataaggatacaaaccggtattttttttagaaacagacaggaataaac |
43948443 |
T |
|
| Q |
111 |
cccaatttaaaagatagaacactgctgatgtttgagggtctacatctgccaatgctcaaatggcccaaatctttatccgttgattagataccctccttca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43948442 |
cccaatttaaaagatagaacactgctgatgtttgagggtctacatctgccaatgctcaaatggcccaaatctttatccgttgattagataccctccttca |
43948343 |
T |
|
| Q |
211 |
caatc |
215 |
Q |
| |
|
||||| |
|
|
| T |
43948342 |
caatc |
43948338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University