View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_235 (Length: 250)
Name: NF1111_low_235
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_235 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 133 - 205
Target Start/End: Complemental strand, 26309888 - 26309816
Alignment:
| Q |
133 |
gctgtacattctgctttaagtggaatgggattccaagacatagagactgtggttgctgtgacaggatggccct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||| |||| ||||||||||||| |
|
|
| T |
26309888 |
gctgtacattctgctttaagtggaatgggattccaagacatagaaattgtggtagctgaaacaggatggccct |
26309816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 38
Target Start/End: Complemental strand, 26311068 - 26311036
Alignment:
| Q |
6 |
gaataaagtaaaagtggacgatagtgaatttgg |
38 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
26311068 |
gaataaagtaaaaatggacgatagtgaatttgg |
26311036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University