View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_239 (Length: 239)
Name: NF1111_low_239
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_239 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 113 - 231
Target Start/End: Complemental strand, 5022003 - 5021885
Alignment:
| Q |
113 |
gcttgtttatgttgcttctcaggtgagttggaagcatttggttccatgttagtgccttttatttttaagggttaattatgattttggttcccttaaatat |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5022003 |
gcttgtttatgttgcttctcaagtgagttggaagcatttggttccatgttagtgccttttatttttaagggttaattatgattttggttcccttaaatat |
5021904 |
T |
|
| Q |
213 |
accaaatgttaattttagt |
231 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
5021903 |
accaaatgttaattttagt |
5021885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 115 - 160
Target Start/End: Complemental strand, 23712061 - 23712016
Alignment:
| Q |
115 |
ttgtttatgttgcttctcaggtgagttggaagcatttggttccatg |
160 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||| |||||| |
|
|
| T |
23712061 |
ttgtttatgttgcttctcaagtgagctggaagcatttggctccatg |
23712016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 180 - 230
Target Start/End: Original strand, 2401807 - 2401857
Alignment:
| Q |
180 |
agggttaattatgattttggttcccttaaatataccaaatgttaattttag |
230 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||| |||| ||||||| |
|
|
| T |
2401807 |
agggttaattatgttttttgtccccttaaatataccaattgttgattttag |
2401857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University