View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_240 (Length: 233)
Name: NF1111_low_240
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_240 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 23 - 214
Target Start/End: Complemental strand, 44559802 - 44559611
Alignment:
| Q |
23 |
gtcattctgagtcggtgatgtgcgatcagttaatgtctggagaaaacaaatcacaaatgacaggtggcaacattattttagctgattgcatggtgcaagt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559802 |
gtcattctgagtcggtgatgtgcgatcagttaatgtttggagaaaacaaatcacaaatgacaggtggcaacattattttagctgattgcatggtgcaagt |
44559703 |
T |
|
| Q |
123 |
tcacgatgacattagaaaatggataatctctgatttggtcggtatggagatggcaattggaaggtgaatattttgatggtgtagatgtgaga |
214 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559702 |
tcacgatgacatgagaaaatggatagtctctgatttggtcgatatggagatggcaattggaaggtgaatattttgatggtgtagatgtgaga |
44559611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University