View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_244 (Length: 230)
Name: NF1111_low_244
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_244 |
 | |
|
| [»] scaffold1452 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 43947556 - 43947743
Alignment:
| Q |
18 |
cacaacaagtttagtcaacaatataaggcaacaattggagctgattttgtcactaaagaacttcaaattgacgacagactcgtcactctacaagtgggtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43947556 |
cacaacaagtttagtcaacaatataaggcaacaattggagctgattttgtcactaaagaacttcaaattgacgacagactcgtcactctacaagtgggtt |
43947655 |
T |
|
| Q |
118 |
tcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaaaagtttgtttatttaagtgggattgtatg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43947656 |
tcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaaaagtttgtttatttaagtgggattgtatg |
43947743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1452 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1452
Description:
Target: scaffold1452; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 781 - 681
Alignment:
| Q |
18 |
cacaacaagtttagtcaacaatataaggcaacaattggagctgattttgtcactaaagaacttcaaattgacgacagactcgtcactctacaagtgggtt |
117 |
Q |
| |
|
||||| ||||| ||||| |||||||| || ||||| || ||||| |||||||| |||||| | || || || ||| |||| || |||||||||||||||| |
|
|
| T |
781 |
cacaagaagttcagtcagcaatataaagctacaatcggtgctgactttgtcaccaaagaattgcagatcgatgaccgactagtgactctacaagtgggtt |
682 |
T |
|
| Q |
118 |
t |
118 |
Q |
| |
|
| |
|
|
| T |
681 |
t |
681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University