View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_245 (Length: 227)
Name: NF1111_low_245
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_245 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 34458539 - 34458689
Alignment:
| Q |
1 |
aatactgctactgttgaatatgagactgaaactcgtcattatgctcatgttgattgtcccggtcacgctgattatgtcaagaatatgattaccggtgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34458539 |
aatactgctactgttgaatatgagactgaaactcgtcattatgctcatgttgattgtcccggtcacgctgattatgtcaagaatatgattaccggtgctg |
34458638 |
T |
|
| Q |
101 |
ctcagatggacggcgctattcttgttgtctccggtgctgatggtcctatgc |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34458639 |
ctcagatggacggcgctattcttgttgtctccggtgccgatggtcctatgc |
34458689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University