View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_247 (Length: 225)
Name: NF1111_low_247
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_247 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 60 - 158
Target Start/End: Complemental strand, 31052684 - 31052586
Alignment:
| Q |
60 |
aataagataaaaattggcctaaatatatgttatattatatgctgtgaaatatatttcagaatcacatcaaattgaaatcaatcgaagcaacagacaaag |
158 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||| ||||||| |||||||| || ||||||||||||||| |||| |
|
|
| T |
31052684 |
aataagataaaatttggcctaaatatatgttatattatatgctatgaaatatacttcataatcacaccaaattgagattaatcgaagcaacagataaag |
31052586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 46424194 - 46424154
Alignment:
| Q |
166 |
tgttgctcttttaagatgaagcggtgaattcattaaatata |
206 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46424194 |
tgttgctcttttaagatgaagcgatgaattcattaaatata |
46424154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 9453007 - 9452967
Alignment:
| Q |
166 |
tgttgctcttttaagatgaagcggtgaattcattaaatata |
206 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9453007 |
tgttgctcttttaagatgaagcggtaaattcattaaatata |
9452967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University