View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_261 (Length: 214)
Name: NF1111_low_261
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_261 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 43947622 - 43947753
Alignment:
| Q |
1 |
attgacgacagactcgtcactctacaagtgggtttcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaaaagtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43947622 |
attgacgacagactcgtcactctacaagtgggtttcttatttcaatgctatttctgcatgcttttgttttttctgttcttggaatgttgtgaaaagtttg |
43947721 |
T |
 |
| Q |
101 |
tttatttaagtgggattgtatgatattgttgg |
132 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
43947722 |
tttatttaagtgggattgtatgatatggttgg |
43947753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University