View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1111_low_265 (Length: 214)
Name: NF1111_low_265
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1111_low_265 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 32502177 - 32502332
Alignment:
| Q |
1 |
gggcatggtaatgttgcatctaaactaattgagtactgttgtcctagttaacacagttgcaaaatgaattataacctagttgaaaatgaattttaatctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32502177 |
gggcatggtaatgttgcatctaaactaattgagtactgttgtcctagttaacacagttgcaaaatgaattataacctagttgaaaatgaattttaatccg |
32502276 |
T |
|
| Q |
101 |
gctgcagtttactgtaacaaagacaaactaaatttgttttggattaatgatgatgt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32502277 |
gctgcagtttactgtaacaaagacaaactaaatttgttttggattaatgataatgt |
32502332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University